Causes of Lower Respiratory Tract Infections and the Use of Diagnostic Biomarkers in Blood Samples from Children in Hohhot, Inner Mongolia, China, Between July 2019 and June 2020

Yanzi Gan; YuWei Hu; Hairong Dong; Lina Wu; Yan Niu

doi:10.12659/MSM.934889

22 March 2022: Clinical Research

Causes of Lower Respiratory Tract Infections and the Use of Diagnostic Biomarkers in Blood Samples from Children in Hohhot, Inner Mongolia, China, Between July 2019 and June 2020

Yanzi Gan ^1ABCDEFG , YuWei Hu ^1BC , Hairong Dong ^1CD , Lina Wu ^1DE , Yan Niu ^12AEF*

DOI: 10.12659/MSM.934889

Med Sci Monit 2022; 28:e934889

Authors information Article notes Copyright and License information

Background Material and Methods Results Discussion Conclusions References

View HTML version

Table 1 Primers for PCR amplification of acute respiratory infection pathogens.

Type of pathogens	Amplification steps	Sequence (5′-3′)	Gene	Gene position	Amplicon size (bp)	References
Adenoviruses	PCR	F: gccgcagtggtcttacatgcacatc	Hexon	18858–18883	308	Polymerase chain reaction for detection of adenoviruses in stool samples
Adenoviruses	PCR	R: cagcacgccgcggatgtcaaagt	Hexon	19158–19136	308
Influenza virus type A	RT-PCR&PCR	F: gaactcrtycywwatswcaawgrrgaaat	NP	319–347	721	Simultaneous detection of influenza A, B, and C viruses, respiratory syncytial virus, and adenoviruses in clinical samples by multiplex reverse transcription nested-PCR assay
Influenza virus type A	RT-PCR&PCR	R: atkgcgcwyrayamwctyarrtcttcawaigc	NP	1040–1009	721
Influenza virus type B	RT-PCR&PCR	F: acagagataaagaagagcgtctacaa	NP	217–242	991
Influenza virus type B	RT-PCR&PCR	R: atkgcgcwyrayamwctyarrtcttcawaigc	NP	1208–1177	991
Influenza virus type C	RT-PCR&PCR	F: gaactcrtycywwatswcaawgrrgaaat	NP	346–374	738
Influenza virus type C	RT-PCR&PCR	R: atkgcgcwyrayamwctyarrtcttcawaigc	NP	1084–1053	738
Respiratory syncytial viruses type A, B	RT-PCR&PCR	F: atggagytgcyratccwcarrrcaartgcaat	F	1–31	737
Respiratory syncytial viruses type A, B	RT-PCR&PCR	R: aggtgtwgttacacctgcattracactraattc	F	737–705	737
Human cytomegalovirus	PCR	F: gaattcagtggataacctgcggcga	IE	197424–197448	406	PCR optimization: Improving of HCMV PCR to achieve a highly sensitive detection method
Human cytomegalovirus	PCR	R: ggatccgcatggcattcacgtatgt	IE	197066–197042	406
Epstein-Barr virus	PCR	F: ggaacctggtcatccttgc	p143	2944–2962	74	Development of a real-time quantitative assay for detection of Epstein-Barr virus
Epstein-Barr virus	PCR	R: acgtgcatggaccggttaat	p143	3017–2998	74
	PCR	F: aatgcgtgatgctggttatgac	siaT	945–966	138	Simultaneous identification of and using real-time PCR
	PCR	R: aagagtttgcgatagattcattgg	siaT	1081–1058	138	Simultaneous identification of and using real-time PCR
	PCR	F: taaacagtttgcctgtagtcg	TIGR4	1926036–1926055	155	Identification of by a real-time PCR assay targeting SP2020
	PCR	R: cccggatatctctttctgga	TIGR4	1926190–1926172	155	Identification of by a real-time PCR assay targeting SP2020
St. hemolyticus	PCR	F: gtaaagcgtgtattccagatttc	cfb	1496075–1496097	199	A multiplex polymerase chain reaction coupled with high-performance liquid chromatography assay for simultaneous detection of six foodborne pathogens
St. hemolyticus	PCR	R: atatgggatttgggataactaagc	cfb	1496273–1496250	199
	PCR	F: gtaatactttagaggagacg	16S rRNA	77–97	225	Application of PCR for detection in children with community-acquired pneumonia
	PCR	R: tacttctcagcatagctacac	16S rRNA	301–281	225

Back to the Article

Causes of Lower Respiratory Tract Infections and the Use of Diagnostic Biomarkers in Blood Samples from Children in Hohhot, Inner Mongolia, China, Between July 2019 and June 2020

Your Privacy