Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

20 August 2021: Animal Study

Knockout of the Cannabinoid Receptor 2 Gene Promotes Inflammation and Hepatic Stellate Cell Activation by Promoting A20/Nuclear Factor-κB (NF-κB) Expression in Mice with Carbon Tetrachloride-Induced Liver Fibrosis

Cuizhen Long 123ABCDEF* , Na Xie 12ABCDEF* , Yuanhui Shu 12ABCF , Yafeng Wu 14ABCF , Ping He 12BC , Yan Zhou 12BC , Yining Xiang 5CD , Junying Gu 12CD , Lei Yang 12DF , Yuping Wang 12ABCDEFG*

DOI: 10.12659/MSM.931236

Med Sci Monit 2021; 27:e931236

Table 2 Primer sequences used for reverse transcription-quantitative PCR.

Gene namePrimer sequences (5′-3′)
ForwardReverse
GAPDHAAGAAGGTGGTGAAGCAGGCATCCGGCATCGAAGGTGGAAGAGTG
TNF-αCGACGTGGAACTGGCAGAAGCACAAGCAGGAATGAGAAGAGG
IL-6ACTTCCATCCAGTTGCCTTCTTGGCCTCCGACTTGTGAAGTGG

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750