Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

05 September 2021: Animal Study

Live Combined and Alleviate Liver Inflammation, Improve Intestinal Barrier Function, and Modulate Gut Microbiota in Mice with Non-Alcoholic Fatty Liver Disease

Jie Jiang 1BCDE , Jie Xiong 1ACEFG* , Jianbo Ni 2CDE , Congying Chen 2CD , Kezhou Wang 3C

DOI: 10.12659/MSM.931143

Med Sci Monit 2021; 27:e931143

Table 1 List of primer sequences used for qRT-PCR.

GenesForward primerReverse primer
IL-1βTTCACCATGGAATCCGTGTCGTCTTGGCCGAGGACTAAGG
TNF-αGGCCTCTCTACCTTGTTGCCCAGCCTGGTCACCAAATCAG
IL-6TTGCCTTCTTGGGACTGATGCCACGATTTCCCAGAGAACA
GAPDHTGTGTCCGTCGTGGATCTGATTGCTGTTGAAGTCGCAGGAG

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750