Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

16 March 2021: Lab/In Vitro Research

Micro-RNA-451 Reduces Proliferation of B-CPAP Human Papillary Thyroid Cancer Cells by Downregulating Expression of Activating Transcription Factor 2

Mei-Feng Zhang ABDE* , Zhe-Wei Fei CE , Lei Huang DE

DOI: 10.12659/MSM.929774

Med Sci Monit 2021; 27:e929774

Table 1 Primer and miRNA sequences.

NameSequences (5′-3′)
ATF2-forwardTACAGCATAGTTCGGTCAG
ATF2-reverseGAGGAAGGAGCCATAACG
ACTB-forwardTGCGTGACATTAAGGAGAA
ACTB-reverseAAGGAAGGCTGGAAGAGT
miR-451AAACCGUUACCAUUACUGAGUU
RNU44CCTGGATGATGATAGCAAATGCTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGACT

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750