Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

14 July 2021: Animal Study

Low Dose of Emodin Inhibits Hypercholesterolemia in a Rat Model of High Cholesterol

Jian-Hong Wu 1ABCDEF* , Chun-Fang Lv 1ABDE* , Xu-Jun Guo 1CDEF* , Huan Zhang 2CF , Jinde Zhang 1BD , Yangfeng Xu 1BD , Jian Wang 1AEG** , Sheng-Yuan Liu 1ACEFG***

DOI: 10.12659/MSM.929346

Med Sci Monit 2021; 27:e929346

Table 1 Primer sequences.

GeneOrientationSequence (5′ to 3′)
eNOSForwardGGATTCTGGCAAGACCGATTAC
ReverseGGTGAGGACTTGTCCAAACACT
LDLRForwardTGGCTATGAGTGCCTATGTC
ReverseGGTGAAGAGCAGAAACCCTA
GAPDHForwardTGCACCACCAACTGCTTAG
ReverseAGTGGATGCAGGGATGATGT
eNOS – endothelial nitric oxide synthase; LDLR – low density lipoprotein receptor; GAPDH – glyceraldehyde-3-phosphate dehydrogenase.

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750