Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

29 May 2021: Lab/In Vitro Research

Silencing Ribosomal Protein L22 Promotes Proliferation and Migration, and Inhibits Apoptosis of Gastric Cancer Cells by Regulating the Murine Double Minute 2-Protein 53 (MDM2-p53) Signaling Pathway

Zhenqing Sun 1ABCE* , Zhigang Qiu 1ABCE* , Zhengkun Wang 1DE , Honghui Chi 2DE , Peipei Shan 3CE*

DOI: 10.12659/MSM.928375

Med Sci Monit 2021; 27:e928375

Table 1 Primer sequences used in the quantitative real-time polymerase chain reaction.

Name of primerSequences (5′-3′)
RPL22-FCATGCCACTTAGGCCATGACT
RPL22-RTGGTAGCCCCTTTCAGTTGTCTA
GAPDH-FGGAGCGAGATCCCTCCAAAAT
GAPDH-RGGCTGTTGTCATACTTCTCATGG
si-RPL22-1-FGCAUUAGAAUUUACGGUGU
si-RPL22-1-RUGAGGAGGUCAACUUCAUC
si-RPL22-2-FGUCAAUAAAAUGCGGGUUU
si-RPL22-2-RAUUAUCCUUUGGAUUCCCG
si-NC-FUUCUCCGAACGUGUCACGU
si-NC-RACGUGACACGUUCGGAGAA
F – forward; GAPDH – glyceraldehyde-3-phosphate dehydrogenase; NC – negative control; R – reverse; RPL22 – ribosomal protein L22; si – short interfering RNA.

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750