Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

10 November 2020: Clinical Research

Differential Levels of Endoplasmic Reticulum Stress in Peripheral Blood Mononuclear Cells from Patients with Sudden Sensorineural Hearing Loss

Zhibiao Liu 12BCDEF , Bing Fei 1BC , Xiaoping Du 3CDF , Yanhong Dai 145DG , Wandong She 145AEFG*

DOI: 10.12659/MSM.927328

Med Sci Monit 2020; 26:e927328

Table 1 Primer sequences for PERK, eIF2α, ATF4, CHOP, and β-actin used in rt-PCR.

PrimerForward primer (5′→3′)Reverse primer (5′→3′)
PERKCTTATGCCAGACACACAGGACAATCCATCTGAGTGCTGAATGGATAC
eIF2αGTGGTTGTCATTAGGGTGGACAAAGCTAACACCTCAGCAACATGACGAAG
ATF4TGCCCGTCCCAAACCTTACTGCTCCGCCCTCTTCTTCT
CHOPCCACTCTTGACCCTGCTTCTCTTGGTTCTCCCTTGGTCTTCCT
β-actinTGGCACCCAGCACAATGAACTAAGTCATAGTCCGCCTAGAAGCA

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750