Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

08 October 2020: Clinical Research

Genome-Scale Expression Pattern of Long Non-Coding RNAs in Chinese Uyghur Patients with Parkinson’s Disease

Dan Wang 1ABE* , Hua Gao 2BDF* , Yanxia Li 3CDF* , Sen Jiang 1CDG* , Yuxuan Yong 1DEF , Xinling Yang 1AFG*

DOI: 10.12659/MSM.925888

Med Sci Monit 2020; 26:e925888

Table 1 PCR primers used in the amplification of lncRNAs.

Gene nameForward primerReverse primer
uc.175+ACCATACTTAATGGACGACCCCATTTAGAACAGACGGCATTCA
TCONS_00023421GCTGGTATCTTGGCCCTTCTACCTCTGAAAAGCCCATTCC
ENST00000435434.1CGTTTCTTCGCCCTCTTCTGATTGATGTCCAGGCTTCTCA

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750