Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

06 September 2020: Animal Study

Biological Network Model of Effect of Chronic Intermittent Hypoxia on Spermatogenesis in Rats

Jisheng Wang 12ABDE* , Xuefeng Gong 3ABEF* , Fanchao Meng 12ABCDEF* , Sheng Deng 12CDF , Hengheng Dai 12BF , Binghao Bao 12BE , Junlong Feng 12BF , Haisong Li 2AG* , Bin Wang 2AE*

DOI: 10.12659/MSM.925579

Med Sci Monit 2020; 26:e925579

Table 1 Primer sequences used for real-time quantitative polymerase chain reaction.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
CCAGCCGTGCTTGAAAACATCTCAACGGCAAAGGTCAGGA
AGGATGAGGCTTTTCGGAGCATCTGGGGCTCTGGAGTAGG
AGCAGCTGCAAGGTCCAAGTACCGACTGCGTGTGTGAAA
GCATCTTCTTGTGCAGTGCCGAGAAGGCAGCCCTGGTAAC

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750