Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

01 September 2020: Animal Study

Chlorogenic Acid Alleviates Allergic Inflammatory Responses Through Regulating Th1/Th2 Balance in Ovalbumin-Induced Allergic Rhinitis Mice

Feilin Dong ABE , Jun Tan CDE , Yi Zheng DF*

DOI: 10.12659/MSM.923358

Med Sci Monit 2020; 26:e923358

Table 1 Primers for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR).

Forward (5′-3′)Reverse (5′-3′)
IFN-γATGAACGCTACACACTGCATCCCATCCTTTTGCCAGTTCCTC
IL-12TGGTTTGCCATCGTTTTGCTGACAGGTGAGGTTCACTGTTTCT
IL-4GGTCTCAACCCCCAGCTAGTGCCGATGATCTCTCTCAAGTGAT
IL-5CTCTGTTGACAAGCAATGAGACGTCTTCAGTATGTCTAGCCCCTG
IL-13CCTGGCTCTTGCTTGCCTTGGTCTTGTGTGATGTTGCTCA

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750